International Journal of Applied Science and Research

Cindy Love A. Cagas 1, Dave P. Mohagan 2, Romeo M. Tubongbanua Jr. 1, Michelle S. Suelo 1, Rona Mae P. Viernes 1, Kent Sean Alan T. Dargantes 1, Aimee C. Abdul 3

DOI: https://doi.org/10.56293/IJASR.2022.5500

ABSTRACT: A new species of weevil under the genus Eupyrgops (Berg, 1898) of the family Curculionidae is discovered on the Salacafe Trail going to Lake Holon, Mt. Melibengoy, T’boli, South Cotabato, Philippines. The genus Eupyrgops is poorly known in the Philippines. There are only 11 species recorded. However, these species were only recorded on Luzon Island. Thus, making this new species a new and lone record in Mindanao, would update the list to 12 species. The new species was collected in an opportunistic manner last May 16-18, 2022. The new species Eupyrgopsalmaesp. nov. has a resemblance with Eupyrgopsmitorajii (Alessandro Bramanti, Andrea Bramanti and RukmaneBarbale, 2020) from Luzon. This single (female holotype) specimen was deposited at the zoology section of the CMU – University Museum as a repository of the vertebrate and invertebrate fauna of Mindanao.

Keyword: Eupyrgops, Lake Holon, Mt. Melibengoy, Curculionidae, Philippines

KETER PHILIP KIBET 1 & ROBERT BELLAMINO MACHYO 2

DOI: https://doi.org/10.56293/IJASR.2022.5501

ABSTRACT: When investors take part in any investment, the main objective is to increase their wealth. This is achieved when share prices increase. The performance of unit trusts in Kenya has however been poor compared to their counterparts in the rest of the world. The poor performance is a discouragement to individual and corporate investors in addition to affecting the realization of financial stability according to the Kenya vision 2030. Empirical literature from developed and emerging markets posits that fund size explains the performance of unit trust funds. This study, therefore, investigated the effects of fund size on the performance of unit trust funds in Kenya. The study adopted an explanatory research design and positivism philosophy. The target population was 16 unit trust firms in Kenya as of the end of the year 2017. The study used a census approach. Secondary data was collected from the audited financial statement of respective unit trusts for the period 2005 to 2017 using a data collection schedule. The study established that fund size has a significant positive effect on performance in all funds. The study concluded that an increase in fund size increases performance. The study recommends that capital market authority should monitor the performance of unit trusts constantly and in addition develop merger policies to encourage small unit trusts to merge to take advantage of economies of scale.

Keyword: Fund Size, Unit Trust Funds, Performance, Unit Trust Funds Performance

Jing-Yao Guan 1, Si-Ming Xie 1, *

DOI: https://doi.org/10.56293/IJASR.2022.5502

ABSTRACT: Lipocalin-2 (LCN2), also known as neutrophil gelatinase associated lipocalin, has been identified as a crucial iron protein that impedes bacterial growth during physiological and inflammatory states. In recent times, the oncological impact of LCN2 has been extensively studied in various cancer types, including colorectal cancer, gastric cancer, prostate cancer, breast cancer, and pancreatic cancer. Different levels of LCN2 have been linked to increased cell proliferation, angiogenesis, cell invasion, and metastasis. Consequently, LCN2 has emerged as a promising therapeutic target against various cancer types. This review consolidates the most notable findings on the expression, biological functions, and regulation of LCN2, along with the proteins with which LCN2 interacts in cancer.

Keyword: lipocalin-2; NGAL; carcinoma; EMT

Fisla Wirda 1, Tuti Azra 2, Novirwan Trinanto 3, Herizon 4

DOI: https://doi.org/10.56293/IJASR.2022.5503

ABSTRACT: This study aims to determine the indicators of entrepreneurial competency and compile the levels of entrepreneurial competency indicators needed from the highest to the lowest level. The research population is the creative industry SMEs in the culinary sector of the city of Padang, with a sample size of 86 managers of the creative industry SMEs in the culinary sector/traditional Padang restaurants, the research location being the city of Padang. This study uses a quantitative approach with the method of SEM and uses Amos as data processing, specifically Second Order Confirmatory Factor Analysis. The results showed the dimensions of entrepreneurial competence needed: conceptual, leadership, learning, opportunity, and personal. The highest level score of the entrepreneurial competence indicator is looking at problems from a positive perspective. The lowest score is recognizing one's strengths and weaknesses and adapting to opportunities and threats. This research is helpful as a reference for indicators of entrepreneurial competency needed for creative industry SMEs in the culinary sector in the city of Padang.

Keyword: entrepreneurial competence, indicators, level

Nurhalimah 1, Belva Putri Salsabila 2,Omi Haryati 3, Wartonah 4, Endang Banon 5

DOI: https://doi.org/10.56293/IJASR.2022.5504

ABSTRACT: Addictive behavior online games the point where teenagers become dependent and lose control. Habits play game online in adolescents lead to changes in character such to become aggressive. Aggressive behavior not only in physical but also take of aggression anger and hostility can hurt people. This study to determine relationship between addictive behavior online games with aggressive behavior of High School students. Type research quantitative cross sectional approach. Population all students of class X-XI of SMAN at Tambun Utara. Sample using total sampling. Instrument used instrument by Chen and Chang (2008) for level online game addiction and the Buss-Perry Aggression Questionnaire Scale (BPAQ) for level aggressive behavior. Analysis data used descriptive statistical and chi-square. The results, it is known characteristics respondents are dominated by boy (63.1%) coming from class XI (64.1%) and 17 years old (47.6%), the type of online game most often played is Mobile Legend (62.1%) with playing duration for 3 hours (62.1%), high online game addiction (52.4%), and high aggressive behavior (57.3%). And results chi square test obtained that p-value of p= 0.001 with = 0.05 (p-value <α ), can be concluded that there is a significant relationship between game addiction and aggressive behavior in students.

Keyword: Teenagers; addictive behavior game online; aggressive behavior

Michelle S. Suelo, Aprille Joy M. Luceno 2, Alma B. Mohagan 2 and 1, Reggie Y. Dela Cruz2

DOI: https://doi.org/10.56293/IJASR.2022.5505

ABSTRACT: The study was conducted for the identification of selected species of family sphingidae through DNA Barcoding in Mt. Kitanglad Lirongan, Lantapan, Bukidnon, Philippines. Thirteen species were collected namely: Acherontia lachesis, Agrius convolvuli, Ambulyx staudingeri, Amplypterus panopus mindanaoensis, Daphnis hypothous, Gnathothlibus erotus erotus, Hippotion brunneum, Hippotion echeclus, Psilogramma menephron, Theretra nessus, Theretra rhesus, Theretra manilae and Theretra sugii. Isolation of the genomic DNA was carried out using the QIAGEN Blood & Tissue Kit. Mitochondrial cytochrome oxidase (COI) gene amplification was carried out using Lep(ATTCAACCAATCATAAAGATATTGG) and LepR1 (TAAACTTCTGGATGTCCAAAAAATCA) primers producing 656-666 base pairs were obtained from 30 samples of sphingid moth species. BLAST analyses were able to identify sphingid to the species level. BLAST hits of COI gene sequence of all 10 species ranged from 95%-99% similarity. Maximum likelihood (ML) and Bayesian inference (BI) was used to examine phylogenetic signals in COI with the highest bootstrap values. Sphingid moths formed a monophyletic group based on the clade

Keyword: DNA Barcoding, Sphingidae, Mitochondrial cytochrome oxidase, Maximum likelihood, Bayesian inference

Gio Vincent A. Balansag 1, Ma. Melanie M. Guiang 2, Alma B. Mohagan 2, and MerlitaTabamo 3

DOI: https://doi.org/10.56293/IJASR.2022.5506

ABSTRACT: Insects account for about 80 percent of animal life on Earth. Distribution of some insects observed in moss cushions ecosystem was conducted at Cinchona Forest Reserve, Lantapan, and Bukidnon, Philippines. Insects are arthropods that inhabits in moss cushions with their associated bacteria, and fungi which provide nutrients for most fauna. The study aimed to determine insects associated with moss cushions in the mossy forest of Mt. Kitanglad, Lantapan, and Bukidnon. The mossy forest has an average elevation of 1,223 meters above sea level. Field sampling through opportunistic survey was employed by recording all the insects observed in moss cushions. Findings revealed a total of 12 families and 21 genera of insects which include the families of Formicidae, Curculionidae, Gryllidae, Blaberidae, Chrysomelidae, Tenebrionidae, Tetrigidae, Cicadelidae, Drosophilidae, Heteropterygidae, Porcellionidae, and Termitidae. Of these, the associated moss families for which insects were observed indicate a total of 7 families, 11 genera, and 18 species. Further, Bryofauna such as insects include organisms that live and eat almost the moss floral species. In tropical regions, numerous moss plant influenced the abundance and distribution of some insects such as the provision of a water refuge to protect from predators. Data suggests some specificity of bryofauna in Cinchona Forest Reserve.

Keyword: arthropods, bryofauna, moss cushions, mossy

Magdi Hassan Saad 1*, Mohammed A. H. Khalafalla 1

DOI: https://doi.org/10.56293/IJASR.2022.5507

ABSTRACT: Removing the picric acid from the liquid isa significant processforan environmentally safe liquid phase. We have conducted systematic calculations basedon density functional theory (DFT) to assess the affinity of carbon nanotube (CNT) towards collecting the picric acid.The picric-CNT interacting structure revealed desirable electrochemical properties in comparison with some other biological molecules (e.g. hydroxychloroquine).Such a finding suggests the stability of the picric-CNT, indicating that the CNT has a strong affinity towards purging the environment from the picric acid. The stability of the picric-CNT structure is further verifiedby the absence of the negative frequency modesfrom the IR spectrum.

Keyword: Picric acid; Carbon nanotube; environment cleaning; DFT calculation

BSc. MSc. Korvah Forleh Kartakpah & Associate. Prof Dr. Engin Baysen

DOI: https://doi.org/10.56293/IJASR.2022.5508

ABSTRACT: Improper waste management practices are a global concern that is impacting the environment, health, and living conditions of households. The practices of corporations and households result in challenges that become evident due to inadequate waste management systems (David, Wenchaoa, Johna & Mmerekib, 2019). The considerations of the people regarding solid waste management can be elevated through spreading awareness of waste management. The awareness levels of the people reflect the practices of waste management that prevail within society. The development of a sustainable infrastructure that includes machinery and systems to correct waste management practices is integral for society. The research focuses on evaluating the lack of proper commercial and domestic waste practices in Montserrado County, Monrovia, Liberia. The method used for this research quantitative method. A structured close-ended questionnaire has been used for conducting a survey analyzing the awareness and practices of the people of Montserrado County. Four hundred respondents' replies were analyzed to better understand people's waste management awareness and habits. The results reflect that people lack awareness of waste management and this reflects in their practices. The religion of the people is a depiction of their lifestyle and household standards.

Keyword: household waste management systems, infrastructure development, sustainability, climate change, environmental challenges

Alma B. Mohagan 1, Jeanne C. Kuan 2, Brylle Vince Abrea 2, Marchie Magdula 2, Donna Joanne Ondap 2, Dave P. Mohagan 3, Aldrin Hongco 4, Fulgent C.P. Coritico 5, and Victor B. Amoroso 5

DOI: https://doi.org/10.56293/IJASR.2022.5509

ABSTRACT: One of the biggest groups of moths in the Sphingidae family is the hawk moth, often known as the sphinx moth, a nocturnal pollinators and bio indicators. They stand out from other moths by having large wings, thick bodies, and longest tongues. There are 1,450 species of Sphinx moth all over the world and 117 of them existed in the Phillippines and Mindanao Island has 62 of them. Mt. Musuan, is one of the remarkable landmark of Central Mindanao University has been subjected to numerous studies of flora and fauna for several years. There were significant studies conducted on Hawkmoths but there were no published report about the species in this locality. This research was carried out on the two vegetation types of Mount Musuan, Maramag, Bukidnon in order to collect data on the composition, endemism, and local status of Hawkmoths. Sphinx moths were successfully collected using transects walks and light trap sampling in the two proposed vegetation sites using a white thin cloth and 500-watt light bulbs. A total of 9 genera and 14 species were recorded. The following are Acosmeryx socrates, Ambulyx bakeri, Ambulyx johnsoni, Ambulyx staudingeri, and Ambulyx wilemani. These were all endemic to the Philippines. There was 1 uncommon species and 13 common species recorded in their local status. The 14 species of sphinx moths comprised 35.7% endemism and these can be found on Mt. Musuan's two vegetation types.

Keyword: Hawk moth, Light trap. Mindanao, Musuan, Philippines

Gio Vincent A. Balansag 1, Edgar M. Anud Jr 2, Gio Patrick A. Balansag 1, KarloAngelo M. Anud 3, and Gia Nice A. Balansag 4

DOI: https://doi.org/10.56293/IJASR.2022.5510

ABSTRACT: This study focuses on the effects of AB mix nutrient solution to the height, number of leaves, and fresh weight of lettuce (Lactuca sativa L.) in hydroponics cultivation system. The growth of lettuce was assessed by comparing the plants' height, number of leaves, and fresh weight of the different levels of AB mix nutrient concentrations (0, 650, 1300, 1950, 2600 ppm) with 2 replications in each treatment. HydroPlus hydroponic nutrients by Green Garages an AB mix nutrient solution were used in this study. The duration of the research investigation started from September 2022 until November 2022. Data obtained from observations were analyzed by using Analysis of Variance (ANOVA) at the accuracy level of 1% and 5%. Data revealed that during the first and second weeks after planting, the AB mix nutrient solution showed positive results on the plant's height in all of the treatments. Moreover, plants began to wilt in the AB mix treatment at 1950 ppm and in the treatment at 2600 ppm during the third and fourth weeks after planting, resulting in significant negative results. The tallest plant's height was obtained in the fourth week after planting with an AB mix of 650 ppm treatment, and the shortest plant's height occurred with an AB mix of 2600 ppm treatment. Although in the AB mix 650 ppm treatment there were plants that were shorter than others, the average height in this treatment was higher compared to other treatments. Data analysis showed that AB mix nutrients have a very significant effect on lettuce's (Lactucasativa L.) number of leaves in the first to the fourth week after planting. The highest number of leaves was obtained from an AB mix concentration of 650 ppm, and the lowest number of leaves was obtained from an AB mix treatment of 2600 ppm. The research investigation revealed that the AB mix nutrient has a very significant effect on the lettuce's fresh weight 30 days after planting. The highest fresh weight was obtained from an AB mix concentration of 650 ppm, and the lowest fresh weight was recorded from an AB mix concentration of 2600 ppm. Based on the results of this study, having too much or too little of the AB mix nutrient solution has a bad effect on the fresh weight of lettuce.

Keyword: nutrient solution, hydrophonics, growth effect

Magdi Hassan Saad 1, 2

DOI: https://doi.org/10.56293/IJASR.2022.5511

ABSTRACT: The results of studies conducted on some skin-lightening creams in the Saudi market indicated that they contain heavy metals in varying proportions that exceed the limits recommended by the World Health Organization, which may cause danger to human health. The study focused on three types of skin-lightening creams, namely Fair & Lovely, Rose, and Diana, to estimate their absorption percentages. In general, the results showed that the relationship between the absorbance rate of skin lightening creams and the wavelength is an inverse relationship, where the absorbance rate decreases with the increase in wavelength. For samples treated with ferment only for skin-lightening creams, the cream with the highest absorption value was Fair & Lovely cream, and the lowest absorption value was Rose cream. In addition, for untreated cream samples, Rose cream had the highest absorption, while Fair & Lovely cream recorded the lowest absorption value. In addition, the samples of creams to which olive oil was added only, without exposure to any other factors, had almost the same absorbance value. Moreover, the samples of creams that were exposed to sunlight varied in their absorbance values, as Rose cream recorded the highest absorption value and Fair & Lovely cream had the lowest absorption value. In the samples of creams that were exposed to X-rays, the results showed that the Diana cream sample and the Rose cream sample had the same pattern and behavior in absorbance.UV spectroscopy (Genesys 10S UV-Vis spectrophotometer) was used.

Keyword: Skin-lightening, Creams, Absorbance, Fair & lively, Rose, Diana

Magdi H Saad 1,*, and Ali Habib Bashal 2

DOI: https://doi.org/10.56293/IJASR.2022.5512

ABSTRACT: We have performed systematic contactless measurements aiming at the determination of the electrical impedance of an oil-water interface. The oil-water interface was formed within an insulin syringe tube due to the oil hydrophobicity. The measurement AC signal (0.1-300 kHz at 0.1 V) was capacitively coupled to the oil-water system through the syringe wall. The interface resistivity was estimated at ~2109m(assuming the interface as a slip layer with width ~ 10 nm) and was associated with hydroxide (OH-) ions, agreeing with existing reports. The resistivity was found to be independent on the signal frequency, which may indicate the nonpolarized nature of the hydrophobic interface. The present impedance spectroscopy is important for hydrophobic systems and may give an insight into the future nondestructive (contactless) investigation of the electrical properties of the lipid layer in the living cell membrane.

Keyword: hydrophobicity, Oil-water interface, Impedance spectroscopy, contactless measurement.

Ikolo 1 O. E., Kamalu 2 O.J. and Chukwumati 2 J.A.

DOI: https://doi.org/10.56293/IJASR.2022.5513

ABSTRACT: Food security is hinged on quality and integrity of the surrounding environment. Food quality and security of coastline communities are tied to the constituents of benthic organisms in the area. This study assessed the heavy metals and hydrocarbons status of sediment and crab (Cardisoma armatum) in Amadi Creek in Port Harcourt. Sediment and crab samples were collected from five stations along a 10 km transect for four months. The heavy metals results for sediment showed the following: Zn (18.624 ± 1.254), Pb (0.791 ± 0.072), Cd (0.031 ± 0.012), Cr (3.323 ± 1.079), Ni (1.848 ± 1.329) and V (0.067 ± 0.102 mg/Kg). The heavy metals ranges in the crab were Zn (20.838 ± 7.803), Pb (0.000 ± 0.000) Cd (0.004 ± 0.014), Cr (0.500 ± 0.239), Ni (1.181 ± 0.562) and V (0.055 ± 0.112 mg/Kg). Hydrocarbon results for sediment were TPH (10.020 ± 11.255), PAH (1.377 ± 1.587 mg/Kg), while the crab had ranges of TPH (1.732 ± 2.235) and PAH (0.003 ± 0.007 mg/Kg). The results were within regulatory permissible limits of EGASPIN and WHO. ANOVA at p>0.05 indicated no significant spatial difference between the heavy metals and hydrocarbon concentrations in the sediments and crab at the various stations along the transect. Sediment heavy metal Ecological Risk Assessment revealed that contamination degree and pollution load index were < 1 (indicating no pollution); geo-accumulation index was grade 0 (unpolluted), individual potential risks and potential ecological risk index were < 40 and < 150 respectively (indicating low ecological risk). Sediment to biota transfer factor indicated that Zn was the only heavy metal biomagnified in the crab. Human health risk assessment of the heavy metals in the crab was less than 1 indicating no obvious health risk for cancer over a lifetime of exposure.

Keyword: Sediments, Heavy metals, Total Petroleum Hydrocarbons, ecological and human risk assessment

Mohammed S. Alzaidi 1

DOI: https://doi.org/10.56293/IJASR.2022.5514

ABSTRACT: Nonorthogonal multiple access (NOMA) is a promising multiple access scheme for 5G wireless networks. However, NOMA faces several challenges that still need to be solved optimally. Deep learning algorithms have been proposed as a potential solution to address these challenges. This review provides an overview of the use of deep learning algorithms to optimize NOMA performance in 5G networks. An investigation is conducted on how deep learning methods are applied in NOMA systems for resource allocation, channel estimation and detection, successive interference cancellation, and user clustering.They can learn optimal user clustering, optimal allocation, and interference alignment strategies, eventually boosting the network performance. In addition, deep learning algorithms can learn the complex relationships between the transmitted symbols and the received signal, leading to accurate detection of the superimposed signals. Opportunities and challenges in NOMA can be identified based on existing research showing how applying deep learning algorithms is better than conventional approaches. The main contribution of this review is to provide insights into the potential of deep learning algorithms to remarkably improve NOMA performance in 5G networks. This article is also a valuable resource for researchers and practitioners interested in using deep learning algorithms for NOMA in 5G networks.

Keyword: NOMA; 5G networks; resource allocation; channel estimation; channel detecting; SIC; user clustering.

Musiwalo Ernest Muthivhi

DOI: https://doi.org/10.56293/IJASR.2022.5515

ABSTRACT: The Fourth Industrial Revolution (4IR) has introduced significant changes to the global telecommunications industry including South Africa. As a result of innovations and changes in digital technology, the South African telecommunications industry is actively adopting the latest applications and processes of digital technology for rendering efficient voice, data and text messaging services to clients. These changes present opportunities for growth in marketshare to telecommunications operators. The paper presents a summary of the main impact of 4IR on the South African telecommunications industry along with challenges and opportunities 4IR presents to the industry. Advanced applications emanating from 4IR are characterised by the integration of new technologies such as artificial intelligence (AI), the Internet of Things (IoT), big data, and cloud computing. These technologies enable the telecommunications industry to offer innovative services and products, improve operational efficiency, and enhance customer experience. However, the implementation of 4IR technologies presents challenges such as cybersecurity risks, the need for upskilling the workforce, and regulatory challenges. Despite these challenges, 4IR technologies offer opportunities for the telecommunications industry to drive economic growth, increase productivity, and create new jobs. This abstract concludes that South African telecommunications companies need to embrace 4IR technologies to remain competitive in a rapidly evolving market.

Keyword: Fourth industrial revolution (4IR), Telecommunications industry, Adoption

Synthia Ona Guserike Afner

DOI: https://doi.org/10.56293/IJASR.2022.5516

ABSTRACT: Sacha inchi is a creeping perennial herb plant that belongs to the Euphorbiaceae family. Sacha inchi, or Plukenetia volubilis is a perennial plant with large, oil-filled seeds. sacha inchi plants began to be widely cultivated. However, in practice it is still planted directly in the field, without going through the nursery first, so the quality of the plants produced varies greatly. Seeding is a process that determines the quality of the plants to be cultivated. Planting media is the media used to grow plants, where roots or roots will grow and develop. A good planting medium must meet requirements such as not containing pest and disease seeds, free of weeds, able to hold water. This study aims to see the effect of the mixture and to get the best mixture of organic matter that supports the growth of Sacha inchi seedlings. This research was conducted from June to August 2022. The research method used was a Randomized Block Design (RAK) with 5 treatments consisting of: Top soil : sand (A), Top soil : sand : burnt husks (B), Top soil : sand : goat manure (C), top soil : sand : bamboo leaves (D), top soil : sand : leftover crickets (E). Data analysis with F test and further test with BNT test level of 5%. Giving organic matter shows better growth than without giving organic matter. Mixture of top soil, sand, and crickets growing media showed optimal growth in number of leaves, number of perfectly opened leaves, widest leaf width, longest leaf length, plant height, fresh weight of plants, and fresh weight of roots.

Keyword: Sacha Inchi Beans, Growing Media, Organic Materials

ALABI T. G.1, OLOTU O.2

DOI: https://doi.org/10.56293/IJASR.2022.5517

ABSTRACT: In this research, the numerical solutions of optimal control problems constrained by ordinary differential equation and integral equation are examined. We obtained the numerical solution by applying the "first discretize then optimize" technique. The discretization of the objective function, differential and integral constraints was done using trapezoidal rule, Simpson's rule and fourth-order Adams-Moulton respectively. Thereafter, the formulated constrained optimization problem was converted into unconstrained problem by applying augmented lagrangian functional. We finally applied the Quasi-Newton algorithm of the Broydon-Fletcher-Goldfrab-Shannon (BFGS) type to obtain our optimal solution. Two examples of optimal control problems constrained by ordinary differential equation and an integral equation are considered. We obtained promising results with linear convergence.

Keyword: Optimal Control Problem, Optimization theory, Algorithms, Discretization, Quasi-Newton, Augmented Lagrangian, Constrained OCP, Unconstrained OCP, Numerical Solution of OCP, Mixed Constraints